Loading
Form preview picture

Get Restriction Enzyme Worksheet Answer Key

Name Restriction Enzyme Worksheet 1 From City Lab s Case of the Missing Crown Jewels. Trustees of Boston University A natural enemy of bacteria is a virus. To defend themselves when attacked by a virus bacteria use chemical weapons that break up the DNA of the virus. The action of the chemicals on the viral DNA is shown in the diagram 1 below DNA from virus cut TACCGGGAATTCATCCGGTGAATTCTAGCGTAC ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG TACCGGG AATTCATCCGGTG GTAGGCCACTTAA AATTCTAGCGTAC GATCGCATG Use the diagram above to answer the following questions 1. The chemical that cuts the DNA is called a. 2. These enzymes cut the DNA which creates different sized. 3. The restriction enzyme used above is called EcoRI. EcoRI cuts DNA everywhere the base pattern is. 4. Another restriction enzyme is called HaeIII. It cuts DNA at the following base sequence CCGG GGCC Show the DNA fragments that would result if HaeIII was used to cut the DNA fragment shown in the first diagram above. Do you think restriction enzymes could be used to cut DNA from other organisms Explain* 6. The words BOB and MADAM are called palindromes. What are palindromes 7. Explain how palindromes are used by restriction enzymes to cut double stranded DNA. To defend themselves when attacked by a virus bacteria use chemical weapons that break up the DNA of the virus. The action of the chemicals on the viral DNA is shown in the diagram 1 below DNA from virus cut TACCGGGAATTCATCCGGTGAATTCTAGCGTAC ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG TACCGGG AATTCATCCGGTG GTAGGCCACTTAA AATTCTAGCGTAC GATCGCATG Use the diagram above to answer the following questions 1. The action of the chemicals on the viral DNA is shown in the diagram 1 below DNA from virus cut TACCGGGAATTCATCCGGTGAATTCTAGCGTAC ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG TACCGGG AATTCATCCGGTG GTAGGCCACTTAA AATTCTAGCGTAC GATCGCATG Use the diagram above to answer the following questions 1. The chemical that cuts the DNA is called a. 2. These enzymes cut the DNA which creates different sized. The chemical that cuts the DNA is called a. 2. These enzymes cut the DNA which creates different sized. 3. The restriction enzyme used above is called EcoRI. EcoRI cuts DNA everywhere the base pattern is. 3. The restriction enzyme used above is called EcoRI. EcoRI cuts DNA everywhere the base pattern is. 4. Another restriction enzyme is called HaeIII. It cuts DNA at the following base sequence CCGG GGCC Show the DNA fragments that would result if HaeIII was used to cut the DNA fragment shown in the first diagram above. 4. Another restriction enzyme is called HaeIII. It cuts DNA at the following base sequence CCGG GGCC Show the DNA fragments that would result if HaeIII was used to cut the DNA fragment shown in the first diagram above. Do you think restriction enzymes could be used to cut DNA from other organisms Explain* 6. The words BOB and MADAM are called palindromes. Do you think restriction enzymes could be used to cut DNA from other organisms Explain* 6. The words BOB and MADAM are called palindromes. What are palindromes 7. Explain how palindromes are used by restriction enzymes to cut double stranded DNA.

How It Works

restriction enzyme worksheet 1 answer key rating
4.8Satisfied
25 votes

Tips on how to fill out, edit and sign Restriction enzyme worksheet online

How to fill out and sign Enzyme worksheet answer key pdf online?

Get your online template and fill it in using progressive features. Enjoy smart fillable fields and interactivity. Follow the simple instructions below:

The preparing of legal documents can be expensive and time-ingesting. However, with our pre-built online templates, everything gets simpler. Now, creating a Restriction Enzyme Worksheet Answer Key takes no more than 5 minutes. Our state-specific web-based blanks and clear instructions eliminate human-prone faults.

Comply with our simple steps to get your Restriction Enzyme Worksheet Answer Key ready quickly:

  1. Select the web sample from the library.
  2. Enter all required information in the required fillable areas. The easy-to-use drag&drop user interface makes it simple to add or relocate areas.
  3. Check if everything is filled out appropriately, with no typos or missing blocks.
  4. Place your e-signature to the page.
  5. Simply click Done to confirm the alterations.
  6. Save the record or print out your PDF version.
  7. Distribute instantly to the receiver.

Use the fast search and advanced cloud editor to generate an accurate Restriction Enzyme Worksheet Answer Key. Eliminate the routine and create documents on the internet!

Get form

Experience a faster way to fill out and sign forms on the web. Access the most extensive library of templates available.

Restriction enzyme worksheet 2 answer key FAQ

Get This Form Now!

Use professional pre-built templates to fill in and sign documents online faster. Get access to thousands of forms.

Keywords relevant to restriction enzymes worksheet key

  • enzymes how do they work worksheet answer key
  • all about enzymes worksheet answers
  • enzyme activity worksheet
  • enzyme cut out activity answer key
  • enzymes worksheet answers
  • enzyme activity worksheet answer key
  • restriction enzymes worksheet
  • how enzymes work worksheet
  • enzymes cut out activity answer key
  • use of a' and 'an worksheet with answers
  • enzyme cut outs activity answer key
  • enzymes answer key
  • enzyme worksheet answers answer key pdf
  • enzyme simulation worksheet answers
  • enzyme structure worksheet answers
If you believe that this page should be taken down, please follow our DMCA take down processhere.
Ensure the security of your data and transactions

USLegal fulfills industry-leading security and compliance standards.

  • 
                            VeriSign logo picture

    VeriSign secured

    #1 Internet-trusted security seal. Ensures that a website is free of malware attacks.

  • Accredited Business

    Guarantees that a business meets BBB accreditation standards in the US and Canada.

  • 
                            TopTenReviews logo picture

    TopTen Reviews

    Highest customer reviews on one of the most highly-trusted product review platforms.